http://rdf.ncbi.nlm.nih.gov/pubchem/patent/WO-2022015702-A2
Outgoing Links
| Predicate | Object |
|---|---|
| assignee | http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_7d6a42d52a510f30420632c6b63359a9 http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_57e701b73718cfa069f993b0e8b585ed http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_2e3c59a75d8ffaf05c8e9883f0c8c9f9 |
| classificationCPCAdditional | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12N2740-15041 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12N2310-20 |
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12N15-86 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/A61K48-005 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12N15-1132 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/A61K39-21 |
| filingDate | 2021-07-13-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| inventor | http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_ef0b25621a26fe493a4949d5cfeab7f9 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_2695604cb9b40c2afa43650780a46bca http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_78e038abb700e9bc7f761bbcb143d306 |
| publicationDate | 2022-01-20-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | WO-2022015702-A2 |
| titleOfInvention | Methods and compositions for crispr/cas9 guide rna efficiency and specificity against genetically diverse hiv-1 isolates |
| abstract | Disclosed are guide RNAs (gRNAs) that specifically bind the 5' LTR human immunodeficiency virus -1 (HIV-1) sequence comprising TTGGATGGTGCTTCAAGTTA (SEQ ID NO: 1). Disclosed are gRNAs that specifically bind the 5' LTR HIV-1 sequence comprising CTACAAGGGACTTTCCGCTG (SEQ ID NO:2). Disclosed are gRNAs that specifically bind the 5' LTR HIV-1 sequence comprising TCTACAAGGGACTTTCCGCT (SEQ ID NO: 3). Disclosed are nucleic acid sequences comprising a nucleic acid sequence encoding one or more gRNAs, wherein said one or more gRNAs hybridize with a target sequence in HIV-1, wherein the target sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO:3. Disclosed are vectors comprising a nucleic acid sequence encoding one or more gRNAs, wherein the one or more gRNA hybridizes with a target sequence in HIV-1, wherein the target sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO:3. Disclosed are methods for inhibiting the function of a target HIV-1 DNA sequence in a cell or removing a target HIV-1 DNA sequence from a cellular genome comprising contacting a cell comprising a cellular genome and harboring a HIV-1 genome comprising a target HIV-1 DNA sequence integrated into the cellular genome with one or more gRNAs, or nucleic acids encoding said one or more gRNAs, and a Clustered Regularly Interspaced Short Palindromic Repeats-Associated (cas) protein, or nucleic acid sequence encoding a cas protein, wherein the one or more gRNAs uniquely hybridizes with the target HIV-1 DNA sequence, wherein the target HIV-1 DNA sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO:3; thereby inhibiting the function or presence of the target HIV-1 DNA sequence. |
| priorityDate | 2020-07-13-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 45.