| Predicate |
Object |
| assignee |
http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_4122ffee5709135c5bff76406c8384d5
http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_b1c51846c62a884f97907703ebc2153b
http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_49d08b978369bd406dbf76146e02e765 |
| classificationCPCAdditional |
http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-156
http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-6858 |
| classificationCPCInventive |
http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-6886 |
| classificationIPCInventive |
http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-68 |
| filingDate |
2012-10-23-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| inventor |
http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_d976cc70852544924c9a6494326cf8cf
http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_40f6950408a5185a94bb6f77f3070e7b |
| publicationDate |
2013-05-02-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber |
WO-2013062976-A1 |
| titleOfInvention |
Methods of detecting braf mutations in cancer |
| abstract |
The disclosure relates to an allele-specific PCR assay for BRAF V600E mutation. The forward primer comprises one of the following sequences: AGGTGATTTTGGTCTAGCTACAGA; G GTG ATTTTG GTCTAG CTACAG A; AGGTGATTTTGGTCTAGCTACCGA; or G GTG ATTTTG GTCTAG CTACCG A; and the reverse primer comprises GTA ACTC AG C AG C ATCTC AG G G. The assay is suitable for use in diagnosis of hairy cell leukemia. |
| isCitedBy |
http://rdf.ncbi.nlm.nih.gov/pubchem/patent/EP-2707508-A4
http://rdf.ncbi.nlm.nih.gov/pubchem/patent/JP-2017521662-A |
| priorityDate |
2011-10-24-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type |
http://data.epo.org/linked-data/def/patent/Publication |