http://rdf.ncbi.nlm.nih.gov/pubchem/patent/RU-2725477-C1
Outgoing Links
| Predicate | Object |
|---|---|
| assignee | http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_ead7823caa72a51f6f525875f1f10f17 |
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-68 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-68 |
| filingDate | 2019-11-15-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2020-07-02-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| inventor | http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_3d4ef0521bec922b93d44a9daef302c3 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_cc8bd1716d65e7e321321f530bb43ac4 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_caf46e27b7c985a837fbf65657c02718 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_28b2d21bb542548918a59a0fa7c544c1 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_d451c85f2819d13ff5aafebc063ab74e |
| publicationDate | 2020-07-02-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | RU-2725477-C1 |
| titleOfInvention | Method for detecting the presence of mutations leading to mycoplasma genitalium resistance to macrolide and fluoroquinolone antibiotics |
| abstract | FIELD: biotechnology. n SUBSTANCE: invention involves a method comprising extracting DNA of a test sample comprising M. genitalium DNA, target PCR amplification, including a portion of a gyrase gene fragment of said M. genitalium GyrB, a portion of the V domain of 23S rRNA gene of said M. genitalium and a ParC QRDR region of said M. genitalium, with fluorescent detection of accumulation of amplification products using probes CGACGAGTTAACTCCCTAGCCTCGTC, Mg23SZwt1-1A and MgParCZwt1, containing different fluorophores at 5'-ends and dampers – at 3'-ends, followed by plotting the amplification products accumulation curve and with determination of k – tangent of inclination angle of linear part of amplification products accumulation curve, F is maximum level of fluorescent signal in sample containing M. genitalium and difference of decimal logarithm of total concentration of M. genitalium in analyzed sample and a decimal logarithm of concentration of M. genitalium in the analyzed sample obtained from amplification of M. genitalium DNA using forward and reverse primers, amplifying the target selected from the V domain of 23S rRNA gene of said M. genitalium and the ParC gene QRDR section of said M. genitalium, wherein if the F value for 23S rRNA fragment is less than 15 %, or if difference of decimal logarithm of total concentration of M. genitalium in analyzed sample and decimal logarithm of concentration of M. genitalium in analyzed sample, obtained as a result of amplification of M. genitalium DNA using forward and reverse primers, amplifying section V of 23S rRNA gene domain of M. genitalium, is more than 0.6, or if k is less than 0.9, then conclusion is made on the presence in the analyzed sample of mutations leading to M. genitalium resistance to macrolide antibiotics, and if the F value for the ParC gene fragment is less than 15 %, or if difference of decimal logarithm of total concentration of M. genitalium in analyzed sample and decimal logarithm of concentration of M. genitalium in analyzed sample, obtained as a result of amplification of DNA of M. genitalium using the forward and reverse primers which amplify the QRDR section ParC gene M. genitalium, is more than 1.0, or if k is less than 0.6, then conclusion is made on the presence of mutations in the analyzed sample, leading to M. genitalium resistance to fluoroquinolone antibiotics. n EFFECT: invention provides a method for detecting mutations of Mycoplasma genitalium, using PCR-RT, which does not require use of additional enzymes, or implementation of additional stages of analysis, wherein allowing to detect the presence of Mycoplasma genitalium contained in the patient's analyzed clinical material, mutations on V section 23S domain of rSNA gene associated with resistance to macrolide antibiotics, as well as the presence of Mycoplasma genitalium contained in the analyzed clinical material from the patient, mutations in the QRDR section of the ParC gene associated with Mycoplasma genitalium resistance to fluoroquinolone antibiotics. n 4 cl, 2 ex, 3 dwg |
| isCitedBy | http://rdf.ncbi.nlm.nih.gov/pubchem/patent/WO-2022016153-A1 http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-114703306-A http://rdf.ncbi.nlm.nih.gov/pubchem/patent/RU-2778666-C1 http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-114703306-B |
| priorityDate | 2019-11-15-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 73.