http://rdf.ncbi.nlm.nih.gov/pubchem/patent/RU-2670949-C9
Outgoing Links
| Predicate | Object |
|---|---|
| assignee | http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_6f7f37be9ba328076ef46f71443089bc |
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C07K14-24 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12N15-74 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-00 |
| filingDate | 2017-09-01-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2018-11-26-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| inventor | http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_6bd2c611f8d2e89d0589d5433d62ec5e http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_d7eeb09bc34338071896e00186a3ad77 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_ac5d3657b2b195c148c018ca9895af42 |
| publicationDate | 2018-11-26-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | RU-2670949-C9 |
| titleOfInvention | Recombinant plasmid expressing cloned genes of biosynthesis of yersinia siderophore pestis, method of its production and yersinia pestis – yersinia superproducent strain |
| abstract | FIELD: biotechnology.SUBSTANCE: invention relates to the field of biotechnology, in particular to the recombinant plasmid pSC-A-5EV. Plasmid pSC-A-5EV is intended for expression of cloned biosynthetic genes of Y. pestis Yersinia. This plasmid contains a PCR copy of four genes (uro1529–1532) of Y. pestis siderophore biosynthesis of 5.6 kb length. This PCR copy is obtained on the Y. pestis EV76 chromosomal DNA template using primers p1529 (CCAAGTTCCTGCATTAGACAGA) and p1532r (CGTTGCCGGATCATTACTGACCCTGAAT). Present invention also relates to a method for constructing plasmid pSC-A-5EV and to a recombinant strain of Y. pestis KM1986. This strain is a superproducer of the siderophore Yersinia of the plague pathogen and is a product of transformation with the plasmid pSC-A5EV strain Y. pestis, which does not synthesize the own Yersinia siderophore.EFFECT: invention makes it possible to obtain pestis Yersinia siderophore in high yield.3 cl, 3 dwg, 3 ex, 1 tbl |
| priorityDate | 2017-09-01-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 168.