http://rdf.ncbi.nlm.nih.gov/pubchem/patent/PL-159234-B1
Outgoing Links
Predicate | Object |
---|---|
classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-48 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N- |
filingDate | 1988-07-14-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
publicationDate | 1992-11-30-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
publicationNumber | PL-159234-B1 |
titleOfInvention | Method of obtaining a protein exhibiting antigenic properties in respect to hiv areole |
abstract | 1. A method of producing a protein with antigenic properties of the g p region 120 of the H IV virus envelope containing am invass 453-518, optionally in combination with a carrier polypeptide, characterized by: synthesized from - c ee DNA of formula (X) nY wherein Y is the sequences: 5 'TCGAGCAATATTACAGGGCTG CTATT - AACAAGAGATGGTGGTAATAG CAACAAT 3' AGCTCGT TG TAA TA A TA TCCCGACGA TT - G TT CTCTACCACCATTATCGTTGT TAGAGTCCGAAATCTTCAGAC CTGGAGGAG - GAGATATGAGGGA AATTGGAGATCTGA r - ACTCAGGCTTTAGAAGTCTGG ACCTCCT - C CTCTATA CTCCCTGTTAACCTCTAGAC TT TTATATAAATATAAAGTAGTA AAAATTGA - ACCATTAGGAGTAGCACCCAC CAAGGCA - AATATATTTATATTTCATCAT TTTTAAC - TTGGTAATCCTCATCGTGGGT GGTTCCGTAAGAGAAGAGTGG TGCAGAGAGAAAAA - AGA TG ATC 3 'T TC TCTTCTCACCACGTCTCTC l TT TTTCTA - C TA G 5' and X sequences: 5 'GA TC CC 3' 3 CTAGGG 5 ' with n = 1 or 0, taken together with their known etodam i / D NA in the expression vector, leads to the convection of the vector into the bacterial cells, the cells are cultivated and a protein with the antigenic properties of the u g p 1 2 0 region is isolated from them. PL |
priorityDate | 1988-07-14-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 240.