| abstract |
(57) [Summary] [PROBLEMS] To provide a reagent for rapidly detecting the presence or absence of a verotoxin type 2 producing bacterium such as O-157. SOLUTION: Any one of the following arrangements or It is an oligonucleotide having a sequence of at least 10 bases or more contained in a sequence complementary to any of the above, and preferably has a fluorescent label at the 5 'end. By having the oligonucleotide, it becomes a fluorescent labeling reagent that specifically hybridizes with the Vero toxin type 2 gene, and the gene can be detected with high sensitivity and reproducibility. TCAGGGGGCGCGTTCTGTTCG, CAGGCGC GTTTTGACCATCTT, CCATCATCAGGGGGCGCGTTC, CGCCG GGAGACGTGGACCTCA, TGGCGGCGGATTGTGCTAAAGG |