| abstract |
The present invention relates to the use of the nucleotide sequence Y45 and / or of the nucleotide sequence Y46, represented respectively by the following sequences SEQ ID N0 1 and SEQ ID N0 2: - SEQ ID NO 1: TCACCGGACGCCGAACTGTGGCGT - SEQ ID NO 2 : TCGCCAACGTTCAGCAGAACAAGT for the implementation of a specific detection and identification method of Erwinia carotovora subsp. atroseptica (Eca), in a given sample, and more particularly in the soil or water, or in a host likely to be a carrier of such bacteria, in particular in plants and seeds, and, where appropriate, for the implementation of a method for the early diagnosis of pathologies liable to be caused by said Eca in the above-mentioned host. |