http://rdf.ncbi.nlm.nih.gov/pubchem/patent/ES-2804308-T3
Outgoing Links
| Predicate | Object |
|---|---|
| assignee | http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_43a72884e25aaecffebe0942132d704f http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_d9231a33cdf4381ca9efddc016491eb3 http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_e5be9456a74cc707cc9ad4370982a402 |
| classificationCPCAdditional | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-16 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-158 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-112 |
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-6886 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-6886 |
| filingDate | 2015-03-10-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2021-02-05-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| inventor | http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_6774882f601e99be2f9997a76c68d0d9 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_9764baf5419c8a11f9f7deb7c520033b http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_dced6e804f7079e8b3f47f49dfc775df http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_20df6624d179022d8eb71bdbd161ff13 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_f51cf709e46dee74cd4681e97e68b2b5 |
| publicationDate | 2021-02-05-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | ES-2804308-T3 |
| titleOfInvention | Methods and kits for classifying diffuse large B-cell lymphoma (DLBCL) into GCB-DLBCL or ABC-DLBCL |
| abstract | A method of classifying a diffuse large B-cell lymphoma (DLBCL) of a subject on a GCB-DLBCL or on an ABC-DLBCL, comprising the step of determining the level of expression of 10 genes in a tumor tissue sample obtained from the subject performing a reverse transcriptase multiple ligation dependent probe amplification assay (RT-MLPA) in which the 10 genes are NEK6, IRF4, IGHM, LMO2, F0XP1, TNFRSF9, BCL6, TNFRSF13B, CCND2 and MYBL1, said method comprising the steps of i) preparing a cDNA sample from the tumor tissue sample, ii) incubating the cDNA sample of step i) with a mixture of at least 10 different pairs of probes specific to a target nucleic acid sequence of NEK6, IRF4, IGHM, LMO2, FOXP1, TNFRSF9, BCL6, TNFRSF13B, CCND2 and MYBL1, iii) ligating the first probe with the second probe of the parts of probes, iv) amplifying the ligated probes produced in step iii) and v) detect and quantify amplicons produced in step iv), wherein the probe pair consists of: - a first probe having - a target specific region (L) complementary to the first segment of the target nucleic acid sequence and - a tail region (TL) at the 5 'end of the target specific region (L) that is not complementary to said target nucleic acid sequence, - a second probe having - a target specific region (R) complementary to the second segment of the acid sequence target nucleic acid and - a tail region (TR) at the 3 'end of the target specific region (R) that is not complementary to said target nucleic acid sequence, wherein the pair of probes specific for NEK6 consists of a first probe which is SEQ ID NO: 54 (GTGCCAGCAAGATCCAATCTAGACCTGTGCATCCTCCTGACCCACAG) and a second probe which is SEQ ID NO: 55 (AGGCATCCCAACACGCTGTCTTTTCCAACCCTTAGGGAACCC); The IRF4-specific probe pair consists of a first probe that is SEQ ID NO: 56 (GTGCCAGCAAGATCCAATCTAGATCTGCCGAAGCCTTGGCGTTCTCAG) and a second probe that is SEQ ID NO: 57 (ACTGCCGGCTGCACATCTGCCTGTATCCAACCCTTAGGGAAC); the IGHM-specific probe pair consists of a first probe that is SEQ ID NO: 58 (GTGCCAGCAAGATCCAATCTAGATGCGTCCTCCATGTGTGGCCCCG) and a second probe that is SEQ ID NO: 59 (ATCAAGACACAGCCATCCGGGTCTTCTACTATCCAACCCTTAGGTCTTCTACTATCCAACCCCCTTAGTCTTCTACTATCCAACCCTTAG); the LMO2-specific probe pair consists of a first probe that is SEQ ID NO: 62 (GTGCCAGCAAGATCCAATCTAGACGGAAGCTCTGCCGGAGAGACTATCTCAG) and a second probe that is SEQ ID NO: 63 (GCTTTTTGGGCAAGACGGTCTCTGCTTAACTATCCAACACCCTGTCTGCCTAACTGGGAACCCT; The FOXP1-specific probe pair consists of a first probe that is SEQ ID NO: 64 (GTGCCAGCAAGATCCAATCTAGACCCTTCCCCTTCAACCTCTTGCTCAAG) and a second probe that is SEQ ID NO: 65 (GCATGATTCCAACAGAACTGCAGCAGCTACTACTGCCAACCCTCCTCCCAGCTACTACTTAGCCAACCCTCCTCCCAGCTACTTA; The pair of probes specific for TNFRSF9 consists of a first probe that is SEQ ID NO: 66 (GTGCCAGCAAGATCCAATCTAGATACGGACCTGTGACATATGCAGGCAGTGTAAAG) and a second probe that is SEQ ID NO: 67 (GTGTTTCCAGGACCAGGACCTAGTGTACTCAGGACCAGGACCTAGTGTACTCAGGACCAGGACCTAGTGTACCC). The pair of probes specific for BCL6 consists of a first probe that is SEQ ID NO: 68 (GTGCCAGCAAGATCCAATCTAGATACTACTCATAAAACGGTCCTCATGGCCTGCAG) and a second probe that is SEQ ID NO: 69 (TGGCCTGTTCTCCACTTTACTAGCCGAACTCCTCCACTTTACAGACGACACTCCTCCACTTTACAGACGACACTCCTCCACTTTACTAGCCGAACTCCTCCA the pair of probes specific for TNFRSF13B consists of a first probe which is SEQ ID NO: 70 (GTGCCAGCAAGATCCAATCTAGATACTACTACTACTAGCGCACCTGTGCAGCCTTCTGCA) and a second probe which is SEQ ID NO: 71 (GGTCCCACTCAGCTGCCGCAAGCCGAGACCTACTACTTA) The CCND2-specific probe pair consists of a first probe that is SEQ ID NO: 72 (GTGCCAGCAAGATCCAATCTAGATACTACTGACCTTCATTGCTCTGTGTGCCACCG) and a second probe that is SEQ ID NO: 73 (ACTTTAAGTTCCTACTCCATGTACCCACCGCCAACGATACTACT) and the pair of probes specific for MYBL1 consists of a first probe which is SEQ ID NO: 76 (GTGCCAGCAAGATCCAATCTAGACCAGAATTTGCAGAGACTCTAGAACTTATTGAAT CT) and a second probe which is SEQ ID NO: 77 (GATCCTGTAGCATGGAGTGACGTACTACTACTTACTGCAGTGACGTACTACCACTTACTGTGCACGTACTACTACTTACTGCAGTGACGTACTACTACTTACT. |
| priorityDate | 2014-03-11-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 269.