http://rdf.ncbi.nlm.nih.gov/pubchem/patent/DE-202021100985-U1
Outgoing Links
| Predicate | Object |
|---|---|
| assignee | http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_a2bcaf91101a370a3d64e3190366357f |
| classificationCPCAdditional | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-6844 |
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-701 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/G01N21-76 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/G01N21-64 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-6888 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-70 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-686 |
| filingDate | 2021-02-26-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2021-06-18-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | DE-202021100985-U1 |
| titleOfInvention | A diagnostic assay kit and means to detect coronavirus nucleic acid |
| abstract | A diagnostic assay kit for the detection of a nucleic acid of the Severe Acute Respiratory Syndrome Corona Virus 2 (SARS-Cov2) in a sample, the diagnostic assay kit comprising a first Corona-LAMP primer set, the first Corona- LAMP primer set comprises the following nucleic acid primer molecules: a) a nucleic acid F3 LAMP primer which (i) comprises a sequence or essentially consists of a sequence that is shown in SEQ ID NO: 47 (GGACCCCAAAATCAG) is shown, or a sequence with no more than 5 or no more than 3, preferably no more than 1 nucleotide change thereof, selected from addition (s), deletion (s) and substitution (s), or (ii) from stringent Conditions hybridized to a target nucleic acid sequence complementary to the sequence shown in SEQ ID NO: 47 (GGACCCCAAAATCAG); andb) a nucleic acid FL-LAMP primer which (i) comprises or consists essentially of a sequence shown in SEQ ID NO: 94 (GTTGAATCTGAGGGTCC) or a sequence of no more than 5 or no more as 3, preferably not more than 1 nucleotide change thereof, selected from addition (s), deletion (s) and substitution (s), or (ii) hybridizes under stringent conditions to a target nucleic acid sequence which is complementary to that in SEQ ID NO: 94 (GTTGAATCTGAGGGTCC) is the sequence shown; andc) a nucleic acid FIP-LAMP primer which (i) comprises a sequence or consists essentially of a sequence shown in SEQ ID NO: 95 (TCTCCATTCTGGTTACTGCCCGAAATGCACCCCGCATTAC) or a sequence with no more than 5 or no more as 3, preferably not more than 1 nucleotide change thereof, selected from addition (s), deletion (s) and substitution (s), or (ii) hybridizes under stringent conditions to a target nucleic acid sequence which is complementary to that in SEQ ID NO: 95 (TCTCCATTCTGGTTACTGCCCGAAATGCACCCCGCATTAC); andd) a nucleic acid B3 LAMP primer which (i) comprises or consists essentially of a sequence shown in SEQ ID NO: 56 (CTTGCCATGTTTGAGTG) or a sequence of no more than 5 or no more as 3, preferably not more than 1 nucleotide change thereof, selected from addition (s), deletion (s) and substitution (s), or (ii) hybridizes under stringent conditions to a target nucleic acid sequence which is complementary to that in SEQ ID NO: 56 (CTTGCCATGTTGAGTG) is the sequence shown; ande) a nucleic acid BL-LAMP primer which (i) comprises or consists essentially of a sequence shown in SEQ ID NO: 53 (CCCCAAGGTTTACCC) or a sequence with no more than 5 or no more as 3, preferably not more than 1 nucleotide change thereof, selected from addition (s), deletion (s) and substitution (s), or (ii) hybridizes under stringent conditions to a target nucleic acid sequence which is complementary to that in SEQ ID NO: 53 (CCCCAAGGTTTACCC) is the sequence shown; andf) a nucleic acid BIP-LAMP primer which (i) comprises a sequence or consists essentially of a sequence shown in SEQ ID NO: 55 (CGCGATCAAAACAACGTCGGAGCGGTGAACCAAGACGCAG) or a sequence with no more than 5 or no more as 3, preferably not more than 1 nucleotide change thereof, selected from addition (s), deletion (s) and substitution (s), or (ii) hybridizes under stringent conditions to a target nucleic acid sequence which is complementary to that in SEQ ID NO: 55 (CGCGATCAAAACAACGTCGGAGCGGTGAACCAAGACGCAG). |
| priorityDate | 2020-06-26-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 498.