| abstract |
The invention provides a specific detection target spot of a Burkholderia Cepacia Complex (BCC) and a constant-temperature rapid detection method. The specific detection target point is secY gene, an RPA primer composition is designed according to the gene, and the RPA primer composition comprises an upstream primer with a sequence selected from one of SEQ ID No. 1-6, a downstream primer with a sequence selected from one of SEQ ID No. 7-SEQ ID No.9, and probes with the following sequences: CAGGGCAACGGAAGATCACGCAGTACACGCGG [ FAM-dT ] A [ THF ] [ BHQ1-dT ] TCACCGTGGTGCTCG [ C3Spacer ]. Based on the above, the invention develops a high-throughput, rapid screening and detection method for specific BCC; the method has high accuracy, strong specificity and high sensitivity, and is suitable for daily screening work of medical institutions, pharmaceutical and medical instrument production enterprises, cosmetic production enterprises and related detection institutions. |