http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-111635934-A
Outgoing Links
| Predicate | Object |
|---|---|
| assignee | http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_cde285efb3088253d750d5d5d0cb8301 |
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-6858 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-6858 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-11 |
| filingDate | 2020-06-22-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| inventor | http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_dc6c7d25b89a8d870cf1a82633f8a75f |
| publicationDate | 2020-09-08-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-111635934-A |
| titleOfInvention | A kind of primer and detection method for detecting mutation of PML-RARA fusion gene PML B2 region |
| abstract | The invention discloses a primer and a detection method for detecting a mutation in the PML B2 region of a PML-RARA fusion gene. The primer includes the following sequences: PML-B2 outer F: CGACTTCTGGTGCTTTGAGTGCGAG; PML-B2 outer R: CAAGGCTTGTAGATGCGGGGTAGAG; PML-B2 inner F: GCAAGACCAACAACATC; PML-B2 inner R: GGGCACTATCTCTTCAG; the detection method of the present invention only needs to adopt a one-step nested PCR amplification and sequencing reaction, so the cost is low; the present invention utilizes the primers obtained by screening to cooperate with the sequencing method, and can accurately know The specific mutation site and type improves the specificity and sensitivity of the detection. |
| priorityDate | 2020-06-22-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 25.