| abstract |
The invention provides a detection method for detecting high temperature tolerance gene TT1 in rice and its dCAPS marker. The primer sequences are: TT1‑dcaps‑F: 5'‑AGTCGAAAGCAAGCACAACAGGATTATC‑3', TT1‑dcaps‑R: 5'‑AGCAGAAACACCGATTCGGAATCAC‑3', the PCR product was digested with the restriction enzyme BsaBI, and digested with 8% polyacrylamide Gel electrophoresis and silver staining. The 143bp band can be detected in the rice material containing the high temperature resistant TT1 CG14 gene. Using the heat-sensitive three-line japonica rice maintainer line Shen 9B, the near-isogenic line NIL (CG14) containing the heat-tolerant allele TT1 CG14 , and the F1 and F2 generation populations between the two, the marker TT1‑dCAPS The results show that the marker can accurately identify different genotypes of rice TT1 gene, such as TT1 WYJ , TT1 CG14 and heterozygous, and can be used for molecular marker-assisted breeding of TT1 gene. |