http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-107648620-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/A61K49-223 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/A61K49-22 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/A61K47-60 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/A61K47-54 |
| filingDate | 2017-09-13-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2020-10-09-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2020-10-09-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-107648620-B |
| titleOfInvention | Targeting ultra-sonar rice bubble carrying CAIX aptamer and preparation method thereof |
| abstract | The invention discloses a targeting hypersonic rice bubble carrying a CAIX aptamer, which comprises a lipid monomolecular shell, a targeting aptamer fixed on the outer side of the lipid monomolecular shell and a biological inert gas wrapped in the lipid monomolecular shell, wherein the targeting aptamer is single-chain DNA, and the gene sequence of the targeting aptamer is as follows: AGCAGCACAGAGGTCAGATGTGGTGCGCAGTGATGTGGTTGGTCCTATGCGTGCTACCGTCCTATGCGTGCTACCGTGAA are provided. The invention aims to provide a targeting hypersonic rice bubble carrying a CAIX aptamer and a preparation method thereof, wherein the targeting hypersonic rice bubble is high in targeting property, strong in tissue penetrating power, small in molecular weight, high in affinity, good in stability and capable of aiming at various tumors. |
| priorityDate | 2017-09-13-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 50.