http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-106596676-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/G01N27-3278 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/G01N27-3277 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/G01N27-327 |
| filingDate | 2016-12-22-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2018-09-28-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2018-09-28-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-106596676-B |
| titleOfInvention | A kind of electrochemical method for microRNAs detections |
| abstract | A kind of electrochemical method for microRNAs detections includes the following steps：A：The preparation of Nano silver solution：B：The preparation of working electrode, including sub-step：B1：In glassy carbon electrode surface electro-deposition gold nanoparticles；B2：The DNA capture probes of electrode surface assembling sulfhydrylation obtained by B1：5'‑TGACTTCAACATCAGTCTGATAAGCTAAGTCAT‑(CH 2 ) 6 ‑SH‑3'；B3：Using the unreacted gold surface of electrode obtained by 6 sulfydryls hexanols closing B2；B4：MicroRNAs is modified to the electrode surface obtained to rapid B3；B5：The Nano silver solution mixture that 4 mercaptophenyl boronic acids and A are obtained is modified into the electrode surface obtained to step B4；C：Electro-chemical test：The electrode that B is prepared carries out electro-chemical test as working electrode is carried out；This method is easy to operate, at low cost, and high sensitivity, test are accurate. |
| priorityDate | 2016-12-22-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 58.