http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-106282354-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-689 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-6851 |
| classificationIPCAdditional | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12R1-01 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-6851 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-04 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-11 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-689 |
| filingDate | 2016-08-26-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2021-03-12-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2021-03-12-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-106282354-B |
| titleOfInvention | Detection primer and fluorescent quantitative PCR detection method for acinetobacter iwoffii |
| abstract | The invention provides an acinetobacter iwoffii fluorescence quantitative PCR detection primer and a method. The nucleotide sequences of the primers are respectively as follows: TTATTTGATCAGGCGCAAAG and CGTTTCTTGCCATCCCATTTA; the detection method comprises the following steps: 1) extracting DNA of a sample to be detected; 2) the DNA is used as a template, the primer is used, the acinetobacter iwoffii is amplified by adopting a fluorescent quantitative PCR method, and the fluorescence value Ct is collected at the annealing stage of 55 DEG C Sample (I) A value; 3) according to the model, the concentration of bacteria is X10 2 、×10 3 、×10 4 、×10 5 、×10 6 、×10 7 Ct of time correspondence Standard of merit Value, establishing the bacteria number lg of A.reuteri Standard of merit And Ct Standard of merit Standard curve of values and according to Ct Sample (I) Values, the number of acinetobacter iwoffii in the sample was determined on the standard curve. The primer provided by the invention has strong specificity and high sensitivity, and the detection limit can reach multiplied by 10 2 cfu/mL, the detection method is rapid and accurate, and the time consumption is short. |
| priorityDate | 2016-08-26-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 37.