http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-105925677-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationCPCAdditional | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-178 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-158 |
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-6883 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-6883 |
| filingDate | 2016-04-29-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2018-02-06-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2018-02-06-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-105925677-B |
| titleOfInvention | Applications of the 3p and 3p of miR 124 of serum excretion body miR 9 as the diagnosis marker of acute cerebral infarction |
| abstract | The invention discloses applications of the 3p and 3p of miR 124 of serum excretion body miR 9 as diagnosis of acute cerebral infarction mark, the sequence of the 3p of miR 9 and miR 124 3p is respectively AUAAAGCUAGAUAACCGAAAGU and UAAGGCACGCGGUGAAUGCC.Excretion body in serum, expression and difference of the specific 3p of the miR 9 and 3p of miR 124 of Fluorescent quantitative PCR (PCR) technical Analysis brain tissue in patients with cerebral apoplexy and healthy population serum excretion body are precipitated using high molecular polymer.After acute cerebral infarction, the 3p of the brain tissue specificity miR 9 and 3p of miR 124 enter peripheral blood in the form of excretion body, its level dramatically increases compared with control group, and the degree of expression quantity and brain damage is proportionate, and can judge cerebral ischemic injury and the mark of degree as a kind of. |
| priorityDate | 2016-04-29-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 80.