http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-105878265-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/A61K31-7105 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/A61P11-00 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/A61K31-7105 |
| filingDate | 2016-05-25-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2018-08-31-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2018-08-31-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-105878265-B |
| titleOfInvention | MiRNA-489 is preparing the application in treating silicosis drug |
| abstract | MiRNA 489 is preparing the application in treating silicosis drug.The present invention provides a kind of applications of the miRNA 489 in treating silicosis drug, the sequence of the miRNA 489 is：5’‑AAUGACACCACAUAUAUGGCAGC‑3’.The present invention is experimentally confirmed：No matter in vitro cellular level or mouse Silicotic model is horizontal in vivo, raise lung inflammation that the expression of miRNA 489 induce silicious dust and fibrosis all has apparent inhibiting effect, this prompt miRNA 489 can become the completely new target spot that silicosis be treated.The present invention will be helpful to the research and development of silicosis medicine, and offer reference for the development of other diseases medicine. |
| priorityDate | 2016-05-25-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 117.