http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-105779619-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationCPCAdditional | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-166 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-158 |
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-6851 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-6895 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-6851 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-6895 |
| filingDate | 2016-05-26-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2020-03-20-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2020-03-20-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-105779619-B |
| titleOfInvention | Method for detecting metabolic capability of plants to formaldehyde by using fluorescent quantitative PCR |
| abstract | The invention discloses a method for detecting the metabolic capability of plants to formaldehyde by utilizing fluorescent quantitative PCR, and primers for the fluorescent quantitative PCR detection are as follows: FALDH-QP 3: tggacttggagcagtttgga, FALDH-QP 4: gccaattattcgtgaagcacc, CK-P1: cctccaatccagacactgta, CK-P2: ggagaagatctggcatcaca, respectively; the primers are used for carrying out fluorescent quantitative PCR amplification on leaves of the plant, and the metabolic capability of the plant to formaldehyde can be rapidly and accurately judged according to the relative expression quantity of the FALDH gene. The plants have certain formaldehyde removing capacity, but different plants have different metabolic capacities on formaldehyde; the metabolic capability of plants to formaldehyde is quickly and accurately analyzed, and the method is helpful for guiding people to select proper flower plants to repair formaldehyde pollution. |
| priorityDate | 2016-05-26-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 40.