http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-105063040-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-6895 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-686 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-04 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-11 |
| filingDate | 2015-09-08-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2018-06-29-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2018-06-29-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-105063040-B |
| titleOfInvention | Phytophthora infestans germ PCR detection primers, kit and detection method |
| abstract | The present invention provides primer, kit and the method for Phytophthora infestans germ PCR detections, the primer includes sense primer PIF：5'GCCATGTCCGGTATTACCAC 3' and downstream primer PIR：5'‑GCTCATCTTCAGACCCTTGG‑3'.Using PCR detection primers, kit and the method for the present invention, the amplified production that clip size is 399bp can be specifically amplified in late disease bacteria pure dna, morbidity tomato plants tissue and the pedotheque that carries disease germs.The present invention has many advantages, such as that accuracy height, high specificity, high sensitivity, detection process are easy to operate quick, available for the early diagnosis of tomato field late blight and the monitoring and identification of germ, is of great significance to the timely and effective prevention of tomato late blight. |
| priorityDate | 2015-09-08-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 32.