http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-105063033-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-11 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-6895 |
| filingDate | 2015-08-15-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2018-06-15-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2018-06-15-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-105063033-B |
| titleOfInvention | A kind of molecular labeling of Brassica Napus knee ospc gene and its application in anti-clubroot breeding |
| abstract | Method of the application present invention by resurveying sequence the invention discloses the molecular labeling of Brassica Napus knee ospc gene PbBa8.1 a kind of and its in anti-clubroot breeding, after polymorphism analysis being carried out to sequence of two parents around PbBa8.1 sites, primer development design is carried out, and then obtain the DNA molecular marker that can distinguish anti-and not anti-clubroot cabbage type rape using the flanking sequence in Indel sites.Primer is designed for the molecular labeling：F A08‑300:5’‑GTAGTGCGGGCCACAAAAT‑3’；R A08‑300:5 ' CACAATGGAGTGTTGAAATTCACT 3 ', the primer can be used for improving the speed and determination rates of anti-knee ospc gene selection and breeding, its easy to implement the method, reproducible, strong operability, identification speed is fast, testing cost is low, time saving and energy saving, greatly alleviates the workload that field carries out disease-resistant Single-plant selection by phenotypic evaluation. |
| priorityDate | 2015-08-15-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 28.