http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-104745712-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-11 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-68 |
| filingDate | 2015-04-20-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2017-08-08-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2017-08-08-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-104745712-B |
| titleOfInvention | A kind of molecular labeling primer related to citrusfruit shelf-life and application |
| abstract | The invention discloses a kind of molecular labeling primer related to citrusfruit shelf-life and application.Marker gene expression quantity during satsuma orange postharvest storage has obvious phasic Chang, and the height of its expression quantity is directly related to citrusfruit resistance and inoxidizability.Utilize the molecular labeling primer：CGGGATGGATGCCAACAA；GCCTGGCCTTTTCCCATAAT, obtains the relative expression quantity of glutathione S transferase gene, can determine that its shelf-life in storage.The primer of the offer of the present invention can accurately indicate orange storing during physiological status, provide good theoretical foundation for the optimal sale period of fruit, and can be that storage reaches the enterprise of kiloton and perform risk profile. |
| priorityDate | 2015-04-20-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 56.