http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-104745576-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-68 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-11 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-12 |
| filingDate | 2014-10-30-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2018-01-30-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2018-01-30-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-104745576-B |
| titleOfInvention | Short-tube lycoris silk floss mealybug specificity SS COI primer pairs and fast PCR detection method and kit |
| abstract | Short-tube lycoris silk floss mealybug specificity SS COI primer pairs of the present invention and fast PCR detection method and kit.The primer pair includes primer PSLRZZF1：5′‑TTTTTGGATTTTGATCAGG‑3′；With primer PSLRZZR1：5′‑AACCATTTAAATGTAAAGAA‑3′.The primer only has amplification ability to short-tube lycoris silk floss mealybug, and amplified production size is 393bp, also has good Detection results to simple grain ovum, incubates nymph and adult residuum.It is the supplement to short-tube lycoris silk floss mealybug morphologic detection authentication method and improvement.Meanwhile the present invention uses SS COI round pcrs, improves the accuracy of detection, has saved detection time, can be promoted in the form of kit in China port, organic vegetable and fresh cutting flower production base, and vegetables, ornamental plant seedling/plant allocation and transportation. |
| priorityDate | 2014-10-30-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 105.