http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-104232618-B
Outgoing Links
| Predicate | Object |
|---|---|
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/G01N21-33 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-10 |
| filingDate | 2014-09-11-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2017-05-31-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationDate | 2017-05-31-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-104232618-B |
| titleOfInvention | Detection smaller ligand target protein RCA products and its detection method |
| abstract | The present invention relates to one kind detection smaller ligand target protein RCA products and its detection method.Using small numerator modified oligonucleotide chain as probe molecule, the sequence of the nucleic acid probe molecules is 5 ' AAATTGAGCTGCAGAATGGGATCGGTACACTGCG NH folate 3 ' to the RCA products.Make use of small molecule that the end protecting effect for producing is combined with the high-affinity high specific of target protein, it is ensured that the high degree of specificity of detection, while by cascade signal amplifying technique, improve the sensitivity of detection.The color change for producing is catalyzed by UV-Vis spectroscopic techniques seizure G, the inventive method simply, quickly, without signal is marked；Sensitivity is high, can in the range of the ng/mL of 1 ng/mL to 500 linearity test folacin receptor albumen, detection be limited to 0.46ng/mL；High specificity, can efficiently differentiate target protein and other reference proteins. |
| priorityDate | 2014-03-06-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 224.