http://rdf.ncbi.nlm.nih.gov/pubchem/patent/CN-102719431-B
Outgoing Links
| Predicate | Object |
|---|---|
| assignee | http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_d6a6f422b091ba12ea61d4adbf1b0e8e |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-68 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12N15-11 |
| filingDate | 2012-06-20-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2013-06-19-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| inventor | http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_0895c90610954feb039ada2ad0e39d21 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_61ff1e0fa725ada34a61a9907041fd2d |
| publicationDate | 2013-06-19-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | CN-102719431-B |
| titleOfInvention | Primer sequence for detecting tetracycline resistant gene tetB in sludge and method |
| abstract | The invention discloses a primer sequence for detecting a tetracycline resistant gene tetB in sludge and a method. The primer sequence comprises a forwards primer and a reverse primer, the base sequences of which are GGCAGGAAGAATAGCCACTAA and AGCGATCCCACCACCAG respectively. The method for detecting the tetracycline resistant gene tetB in the sludge comprises: (1) extracting the DNA of a sludge sample to be detected and performing a quantitative polymerase chain reaction (PCR) amplification with the forwards primer and the reverse primer by taking the extracted DAN as a template and recording the cycle number reaching the fluorescence threshold; and (2) referring the cycle number obtained in step (1) to the standard curve of the target gene tetB plasmid standard measured by the quantitative PCR to obtain the content of the tetracycline resistant gene tetB in the sludge sample to be detected. The primer sequence and detection method of the invention implement the fast and precision quantitative detection of the tetracycline resistant gene tetB in the sludge. |
| priorityDate | 2012-06-20-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 19.