http://rdf.ncbi.nlm.nih.gov/pubchem/patent/AU-2014216054-B2
Outgoing Links
| Predicate | Object |
|---|---|
| assignee | http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_9b7e3799d02776160735934b621d0747 |
| classificationCPCAdditional | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/Y02A50-30 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-68 |
| filingDate | 2014-08-25-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| grantDate | 2015-11-19-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| inventor | http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_a8b54a231b029ce3365ea8853d65a63f http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_205673904a917cff4cc64e1c893264c3 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_9342fa5b01a0bea01dee15e75ca22f37 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_e2208174c37bf00e5157b668150828f3 http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_f893eef4d69ac768bdfec7157724ff89 |
| publicationDate | 2015-11-19-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | AU-2014216054-B2 |
| titleOfInvention | Cultures with improved phage resistance |
| abstract | The present invention provides methods and compositions related to modulating the resistance of a cell against a target nucleic acid or a transcription product thereof. In some preferred embodiments, the present invention provides compositions and methods for the use of one or more cas genes or proteins for modulating the resistance of a cell against a target nucleic acid or a transcription product thereof. In [0 some embodiments, the present invention provides methods and compositions that find use in the development and use of strain combinations and starter culture rotations. In additional embodiments, the present invention provides methods for labelling and/or identifying bacteria. In some preferred embodiments, the present invention provides methods for the use of CRISPR loci to determine the potential virulence of a phage against a cell and the use of CRISPR-cas to modulate the genetic sequence [5 of a phage for increased virulence level. In still further embodiments, the present invention provides means and compositions for the development and use of phages as biocontrol agents. A DGCC7710> )RT R S1 R S2 R R S30 R S31 R S32 RT Challenge the strain with phage 858 and select a phage resistant mutant DGCC7710RH1 R) R Sn R S1 R S2 R R S30 R S31 R S32 RT The CRISPR I locus of the mutant has an additional spacer which shares 100% identity with region 31 921-31 950bp of the phage R R S1 R S2 R R S30 R S31 R S32 RT Space TCAACAATTGCAACATCTTATAACCCACTT 858 TCAACAATTGCAACATCTTATAACCCACTT |
| priorityDate | 2007-03-02-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 348.