http://rdf.ncbi.nlm.nih.gov/pubchem/patent/AU-2011340099-A1
Outgoing Links
| Predicate | Object |
|---|---|
| assignee | http://rdf.ncbi.nlm.nih.gov/pubchem/patentassignee/MD5_32db25dbe9d0860567d8721e3bb9ba6d |
| classificationCPCAdditional | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-156 http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q2600-112 |
| classificationCPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentcpc/C12Q1-701 |
| classificationIPCInventive | http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-68 http://rdf.ncbi.nlm.nih.gov/pubchem/patentipc/C12Q1-70 |
| filingDate | 2011-12-09-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| inventor | http://rdf.ncbi.nlm.nih.gov/pubchem/patentinventor/MD5_2cc8c1f3f2f5f06201b4dfe51817695f |
| publicationDate | 2013-07-11-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| publicationNumber | AU-2011340099-A1 |
| titleOfInvention | Determination of the virulence of infectious pancreatic necrosis virus in fish |
| abstract | A method for determining the virulence of infectious pancreactic necrosis virus (IPNV), Sp serotype, in a fish sample, comprises: (a) determining the presence of IPNV in a fish population by taking a tissue sample from the fish and selecting the samples with the greatest viral load; (b) extracting the RNA from the samples selected in step (a); (c) amplifying the discrete region of the VP2 protein that contains the residues 271 and 221 from an eluate of the RNA extracted in step (b) using the following primers: IPNa1: GGGACGTCATTGTCAAGGCC and IPNs7: CGTCCGCCTAGAGGACGAGAC';(d) purifying the amplification products obtained in step (c); (e) sequencing the purified amplification product from step (d); translating the resultant nucleotide sequence into an amino acid sequence; and (f) identifying the presence of the threonine or proline residues in position 217 and of the alanine residue in position 211 of the amino acid sequence obtained in step (e), in order to establish whether the IPNV exhibits very high or medium virulence, respectively. The mixture of primers, IPNa1: GGGACGTCATTGTCAAGGCC and IPNs7: CGTCCGCCTAGAGGACGAGAC, is also claimed. |
| priorityDate | 2010-12-10-04:00^^<http://www.w3.org/2001/XMLSchema#date> |
| type | http://data.epo.org/linked-data/def/patent/Publication |
Incoming Links
Total number of triples: 17.